Escuela de Medicina Veterinaria, Universidad Nacional

Save this PDF as:

Tamaño: px
Comenzar la demostración a partir de la página:

Download "Escuela de Medicina Veterinaria, Universidad Nacional"


1 Ph.D Bernardo Vargas Leitón, Escuela de Medicina Veterinaria, Universidad Nacional



4 Formación y Especialización de razas Selección empírica del ganado Nace la Genética Clásica (Leyes de Mendel) Primeras Asociaciones de Raza Inicio de los Registros Genealógicos Congelación Semen/Ins. Artificial Pruebas de progenie Modelo de ADN (Watson y Crick) Transferencia de Embriones/ FIV Modelo Animal para Cálculo de Valor Genético Selección Asistida por Marcadores Genéticos Secuenciación de Genoma Bovino Selección Genómica

5 Nucleótidos (SNP) cromosoma A-Adenina A Adenina C C-Citosina Citosina G-Guanina T-Timina Gen 5

6 Abuelos GENES NUCLEOTIDOS (SNP) Padres El genoma bovino está contenido en 30 pares de cromosomas Cromosomas Un miembro del par cromosómico proviene del padre y el otro de la madre Cría El azar determina la composición genética de un animal


8 1. Dfii Definir la Meta (objetivo) de selección (Ej. Producir carne) 2. Medir rasgos relacionados con Meta (Ej= Ganancia de Peso gramos/día) 3. Calcular valores genéticos (Ej= DEP/ Diferencia Esperada Progenie) 4. Seleccionar individuos superiores (Ej= 5% superior en DEP) 5. Realizar apareamientos controlados entre individuos superiores 6. repetir (1 a 5) en cada generación!!! POR QUE FUNCIONA? Porque la selección por Ganancia de Peso aumenta la frecuencia de los genes relacionados con crecimiento

9 (Indispensable) Identificación UNICA y PRECISA!!! Producción kg leche kg % grasa kg % proteína Tipo Ubre Patas etc Salud Mortalidad Mastitis i (CCS) Problemas de patas Producción Ganancia de Peso Terneza de la carne Marmoleo Fertilidad Edad a parto %Preñez/Int. Entre Partos Servicios Concepción Consumo de alimento kg concentrado kg suplementos Peso corporal La mayoría de los rasgos de importancia comercial (ej. producción de leche, peso corporal, tamaño, velocidad, etc) están definidos por la acción conjunta de una considerable cantidad de genes (son poligénicos).

10 HATOS Registro de Información de pedigree y rendimientos Plantas Industriales Procesadoras de Alimentos Mataderos Laboratorios privados Centro de Análisis (Estimación y distribución de valores de cría) Centros de I.A Crianza de sementales Recolección y distribución semen Organizaciones ganaderas Asociaciones de raza (Registro genealógico) Los programas de mejoramiento genético a nivel poblacional involucran la participación coordinada de los distintos sectores (productores, asociaciones, industria, etc)

11 individuo X A (255) D (225) B (225) E (180) C (240) Representación gráfica (Arbol Genealógico) Representación gráfica (de valores de cría) F (225) G (230) X (235) H (221) I (220) J (225) K (220) L (200) M (185) Archivo de Entrada DEP DIFERENCIA ESTIMADA DE PROGENIE / Ganado de Carne PTA HABILIDAD DE TRANSMISION PREDICHA/ Ganado de Leche Ejemplo: DEP= 2.37 kg, se espera que su progenie sea superior al promedio


13 Se tarda mucho tiempo para obtener un estimado confiable del valor genético (DEP/ PTA) (Ej Hasta 5 años en un toro lechero) Es difícil comparar animales criados en distintas condiciones (Ej. Consumo de concentrado vs. Pastoreo) Alto costo de la medición de los rasgos en una población grande (Ej. Medición de producción en cientos de vacas) Muchos rasgos solo se pueden medir en un sexo (Ej. Producción de Leche) Muchos rasgos solo se pueden medir en edad adulta (Ej. Longevidad) Muchos rasgos solo se pueden medir después de sacrificio (Ej. Calidad de la carne) Para medir el rasgo a veces es necesario exponer al animal a condiciones inadecuadas (Ej. Resistencia a enfermedades )

14 F _Dog_EquiPerRun01 Per888 G H I J K L M N O P Q R S I HMS3 H _Dog_EquiPerRun01 Per G H I J K L M N O P Q R S I O 165 Muestra: Pelo Sangre Semen Extracción de ADN Cuantificación del ADN Amplificación por PCR Desde finales del siglo XX ya existen tecnologías que permiten la identificación de genes relacionados con características específicas Se han utilizado para: 1. Identificación de Portadores de anomalías genéticas éi 0 HMS3 G _CCT_EqRun01 CTE15 G H I J K L M N O P Q R S M P HMS3 Detección de los alelos mediante el Electroferograma Detección de las variantes alélicas a través del secuenciador automático Chequeado del producto de PCR 2. Selección Asistida por Marcadores (M.A.S). 3. Identificación/Verificación de Parentescos/Trazabilidad) LIMITACIONES: Inicialmente el alcance de estas tecnologías fue limitado y su costo muy alto, por lo que su uso había sido bastante puntual

15 EPITELIOGENESIS IMPERFECTA recesivo AGNACIA recesivo, solo machos ACONDROPLASIA ((BULLDOG, recesivo)) ALOPECIA recesivo CARA TORCIDA ((recesivo)) SINDACTYLIA ((PATA DE MULA, recesivo)) LIMITACIONES: Son muy pocas las anomalías causadas por un solo gen MALFORMACION VERTEBRAL COMPLEJA (CVM,recesivo) MIELOENCEFALOPATIA La mayoría de las enfermedades son (recesivo) poligénicas y multifactoriales ENANISMO (recesivo)

16 GENES DE IMPORTANCIA PARA UN RASGO (Ej. TERNEZA) MARCADORES ASOCIADOS (NUCLEOTIDOS) Conforme el análisis de ADN se hizo más eficiente fue posible explorar más en detalle el genoma Ej 1 Terneza de la Carne Se identificaron variantes moleculares (MARCADORES) localizados en cromosomas específicos que se asocian con algunos rasgos de gran importancia económica La ) hizo posible identificar los individuos portadores de variantes favorables Ej 2 Calidad de la Leche

17 Terneza de la Carne: 3 marcadores asociados (T1,T2,T3) Las pruebas de ADN indican cuántas copias tiene un animal de la variante favorable para terneza de la carne (2 copias ) LIMITACION: Aunque los marcadores (T1,T2, T2 T3) son importantes, en realidad existen muchos más genes involucrados en la terneza de la carne (1 copia ) (ninguna copia

18 El análisis de ADN constituye una huella genética imborrable, por lo que puede ser utilizada para: Verificación de parentescos : Confirmación de genealogía para evaluaciones genéticas, genética forense (CSI), transacciones comerciales, etc. Trazabilidad: Rastreo de animales (o sus productos ) a lo largo de una cadena de comercialización (origen de contaminaciones)

19 Dominette (Hereford) AGTCCATGGGGTTGCAGAGTCAGACAC AGTGGAGTCACACACATACACACGGC CCCACGCTGGGTTAAGGCGGGGCTGA GACAAGGGCAGGTGAGGCCTCCCA El rompecabezas bovino tiene aprox 3 billones de piezas (A T C G) y genes Curiosidades: Los bovinos tienen cerca del 80% de los genes en común con los humanos Hay más similitud entre humanos y ratones que entre humanos y vacas

20 Secuenciar el Genoma no es lo mismo que ENTENDER el Genoma Para entender el GENOMA es necesario secuenciar múltiples animales y establecer asociaciones entre diferentes Genotipos y diferentes Fenotipos AGTCCATGGGGTTGCA GGGG GC GAGTCAGACACAGTG GAGTCACACACATACA CACGGCCCCACGCTG GGTTAAGGCGGGGCTA GACAAGGGCAGGTGA TCGATCGAGCCTCCCA aaa PERO Secuenciar el Genoma completo de todos los vacunos de una población O Secue c a e Ge o a co p eto de todos os acu osde u a pob ac ó es todavía muy caro!

21 Es posible realizar ESCANEOS EN SITIOS (MARCADORES) ESTRATEGICOS del genoma mediante chips genómicos por precios razonables Ejemplos (Asoc. Holstein/ USA): Baja Densidad 9 K= marcadores $45 Alta Densidad 50 K= marcadores $125 Super Alta Densidad 800 K= marcadores $225

22 Toros probados (Referencia) Análisis de ADN (SNP) (chip de SNiPs) + Evaluaciones genéticas tradicionales (PTA leche o EPD carne, etc) Ecuación de predicción (SNP= PTA) Toros jóvenes Análisis de ADN (SNP) + GENEALOGIA (PA) SELECCION (PTA) GENOMICO

23 A B A B Selección Tradicional Selección Genómica TERNERO MERITO GENETICO ($) SELECCION TRADICIONAL SELECCION GENOMICA A $416 $411 B $416 $207 Confiabilidad 35% 70% En selección tradicional 2 terneros recién nacidos (hermanos completos) tendrían un mismo valor genético, mientras que en selección genómica podría ser muy distinto

24 Se requiere de una Población de Referencia de tamaño considerable (miles de animales) para establecer Asociaciones SNP= PTA que sean más confiables que la Selección Tradicional Las asociaciones ENTRE MARCADORES Y VALORES GENETICOS pueden ser distintas en diferentes razas, lo que implica que deben formarse diferentes poblaciones de referencia para cada raza Las asociaciones ENTRE MARCADORES Y VALORES GENETICOS pueden cambiar en el transcurso del tiempo

25 AYRSHIRE PARDO SUIZO GUERNSEY HOLSTEIN JERSEY SHORTHORN Otros Durante los últimos 4 años más de bovinos lecheros ya han sido genotipados utilizando chips genómicos de baja, media o alta densidad Casi 2/3 de los toros IA (HOLSTEIN) comercializados actualmente son Toros Genómicos!!

26 PRODUCCION DE LECHE Cada punto representa un marcador genético (SNP) Los colores representan diferentes cromosomas Los puntos más altos indican marcadores con mayor relación para producción de leche FUERZA DE ASOCIACION



29 Fuente: Holstein World Hay un marcado aumento en confiabilidad para evaluaciones genómicas (en la raza HOLSTEIN) Progreso genético= Intensidad d (+) Confiabilidad d (+) Variación ió genética Intervalo entre Generaciones (-)

30 Mérito Neto ($) Genómico (2010) Con +100 hijas (2013) Fuente: Holstein World Se comprueba que las predicciones genómicas son eficientes En 300 toros las diferencia promedio en MN ( ) fue $150, o sea, las evaluaciones genómicas tienden a sobre estimar el potencial genético

31 Se obtienen los perfiles genéticos de 2 grupos : Individuos Normales (Control) vs. Individuos Enfermos (Casos) usando chips de alta densidad (>1 millón K) Se comparan estadísticamente ambos grupos y se detectan los SNP con mayor fuerza de asociación con la enfermedad

32 Pruebas de ADN Respuesta a Medic A Respuesta a Medic B Tratamiento A Tratamiento B Drogas diseñadas para perfiles genéticos específicos Diagnóstico de predisposición genética para distintas patologías

33 Aumento de la Confiabilidad de la selección Reducción del Intervalo Generacional Aumento de la Intensidad de Selección MAYOR PROGRESO GENETICO Mejor uso de recursos limitados de evaluación Evaluación de rasgos de difícil medición Oportunidad para Estudios de Asociación del Genoma Completo G.W.A.S Oportunidad para reducir la consanguinidad Oportunidad para apareamientos complementarios según perfil genómico


Cuadro 1. Promedios productivos nacionales el año 1997 (3.995 lactancias) y el año 2009 (12.309 lactancias).

Cuadro 1. Promedios productivos nacionales el año 1997 (3.995 lactancias) y el año 2009 (12.309 lactancias). MEJORAMIENTO GENÉTICO Y PRODUCCIÓN DE SÓLIDOS EN SISTEMAS PASTORILES Méd. Veterinario M. S. Ph. D. Héctor Uribe M. Departamento de Producción Animal, Universidad de Chile I. Introducción La tendencia mundial

Más detalles

>>> Bovinos de Carne Interpretando resultados

>>> Bovinos de Carne Interpretando resultados >>> Bovinos de Carne Interpretando resultados Utilizando el poder del ADN, IGENITY lo ayuda a conocer y manejar el potencial genético de sus animales para características económicamente importantes. El

Más detalles

Mejoramiento Genético en Bovinos de Carne. Rolando Demanet Filippi Universidad de La Frontera

Mejoramiento Genético en Bovinos de Carne. Rolando Demanet Filippi Universidad de La Frontera en Bovinos de Carne Rolando Demanet Filippi Universidad de La Frontera El MGA consiste en aplicar principios biológicos, económicos y matemáticos, con el fin de encontrar estrategias óptimas para aprovechar

Más detalles


BIOTECNOLOGIA PECUARIA 1ro9ber4to5 BIOTECNOLOGIA PECUARIA La demanda por productos animales ha crecido constantemente y es necesario incrementar la cantidad y calidad de estos productos. En este contexto, en los últimos 20 años

Más detalles

Uruguay. Abril 2015. David Sellars Gerente Técnico, Mercados Emergentes e Innovación Livestock Improvement Corporation

Uruguay. Abril 2015. David Sellars Gerente Técnico, Mercados Emergentes e Innovación Livestock Improvement Corporation Uruguay Abril 2015 David Sellars Gerente Técnico, Mercados Emergentes e Innovación Livestock Improvement Corporation Nueva Zelanda LIC, descripción Cooperativa Enfocada comercialmente 12.000 clientes en

Más detalles


CRITERIOS DE SELECCIÓN PRUEBAS DE PROGENIE INTERPRETACION DE CATALOGOS CRITERIOS DE SELECCIÓN PRUEBAS DE PROGENIE INTERPRETACION DE CATALOGOS Jorge Oltra Comte El inicio de un proceso de Selección y Mejoramiento Genético lleva principalmente a pensar y tratar de definir cuál

Más detalles

Situación y perspectivas. del empleo de. Marcadores Genéticos. Ing. Agr. Pablo M. Corva, PhD Facultad de Ciencias Agrarias Univ. Nac.

Situación y perspectivas. del empleo de. Marcadores Genéticos. Ing. Agr. Pablo M. Corva, PhD Facultad de Ciencias Agrarias Univ. Nac. Situación y perspectivas del empleo de Marcadores Genéticos Ing. Agr. Pablo M. Corva, PhD Facultad de Ciencias Agrarias Univ. Nac. Mar del Plata El ADN es una estructura de una complejidad admirable Pero

Más detalles



Más detalles

Ideal para cruces. Noviembre 2014. Publicación de Genética Selecta S.A.

Ideal para cruces. Noviembre 2014. Publicación de Genética Selecta S.A. Noviembre 2014 Publicación de Genética Selecta S.A. Hija de Braut, F1 Holstein x Rojo Noruego Primera lactancia, Proy 305d 7.850kg / 5,27%Grasa / 3.63% Proteína Ideal para cruces + Enfermedades Fertilidad

Más detalles



Más detalles

Programa de mejora genética

Programa de mejora genética Programa de mejora genética Ing. Agr. Olga Ravagnolo INIA Las Brujas 7 de Setiembre 2015, Mejoramiento Genético en Bovinos para Carne INIA Tacuarembó Proceso de Mejoramiento Genético 3 PREGUNTAS A) Dirección:

Más detalles


MEJORA GENÉTICA EN EL GANADO PORCINO MEJORA GENÉTICA EN EL GANADO PORCINO PORCINO Elevada eficacia productiva Ciclo productivo y reproductivo intenso + - elevado nº de crías/parto - intervalo generacional corto -elevada h 2 de caracteres

Más detalles

Calidad de Canal y Carne. Calidad de Leche. Registros Fenotípicos. Registros Moleculares

Calidad de Canal y Carne. Calidad de Leche. Registros Fenotípicos. Registros Moleculares MEJORAMIENTO GENÉTICO BOVINO PARA CALIDAD DE CARNE Y LECHE M. A. Elzo Universidad de Florida Calidad de Canal y Carne Madurez del Animal (2.5 a 3.5 años) Porcentaje de Cortes de Venta (Yield Grade) Aspecto

Más detalles

UNA EXPERIENCIA EN AGRARIAS: Patentar solos o hacer camino para los que vienen detrás?

UNA EXPERIENCIA EN AGRARIAS: Patentar solos o hacer camino para los que vienen detrás? UNA EXPERIENCIA EN AGRARIAS: Patentar solos o hacer camino para los que vienen detrás? Ana Meikle LABORATORIO DE TECNICAS NUCLEARES FACULTAD DE VETERINARIA INTRODUCCIÓN La presión genética sobre la producción

Más detalles

Explorando el potencial de mejora genética por eficiencia alimenticia en ganado de carne Angus

Explorando el potencial de mejora genética por eficiencia alimenticia en ganado de carne Angus Ana Inés Trujillo Dpto de Producción Animal y Pasturas. Fac. de Agronomía. Seminario Técnico INIA Agosto 2013 Explorando el potencial de mejora genética por eficiencia alimenticia en ganado de carne Angus

Más detalles

Seminario de Biotecnologías Reproductivas para el Mejoramiento Genético Bovino. Convenio INDAP-UACh Región de Los Lagos

Seminario de Biotecnologías Reproductivas para el Mejoramiento Genético Bovino. Convenio INDAP-UACh Región de Los Lagos Seminario de Biotecnologías Reproductivas para el Mejoramiento Genético Bovino Convenio INDAP-UACh Región de Los Lagos Política Económica y Comercial Chilena: Apertura, liberalización, desarrollo exportador

Más detalles

Cria y recria de vaquillas y efectos en parámetros productivos futuros

Cria y recria de vaquillas y efectos en parámetros productivos futuros Cria y recria de vaquillas y efectos en parámetros productivos futuros El reemplazo de vaquillas representa el futuro productivo del plantel lechero, por tal motivo es necesario un adecuado manejo y nutrición

Más detalles

Capítulo 8. Mejoramiento genético en bovinos

Capítulo 8. Mejoramiento genético en bovinos Capítulo 8. Mejoramiento genético en bovinos Capítulo 8. Mejoramiento genético en bovinos Facultad de Medicina Veterinaria y Zootecnia-UNAM 267 Enciclopedia Bovina 268 Capítulo 8. Mejoramiento genético

Más detalles

Práctico 1. Estadística y Dinámica de Poblaciones

Práctico 1. Estadística y Dinámica de Poblaciones Práctico 1 Estadística y Dinámica de Poblaciones Principales conceptos El mejoramiento genético está referido a poblaciones. La caracterización de poblaciones así como el entendimiento de la Mejora Genética

Más detalles

Ganadería de Carne. Agro. Aníbal II Ruiz Lugo

Ganadería de Carne. Agro. Aníbal II Ruiz Lugo Ganadería de Carne Agro. Aníbal II Ruiz Lugo Master in Science Conceptos Básicos Nombre científico Bos Taurus (Razas Británicas y Europeas originalmente, razas nuevas USA) Bos Indicus (Países tropicales

Más detalles



Más detalles


LOS EBVS DE BREEDPLAN - LAS CARACTERÍSTICAS EN DETALLE - LOS EBVS DE BREEDPLAN - LAS CARACTERÍSTICAS EN DETALLE - BREEDPLAN actualmente produce EBVs para 19 características de importancia económica. Estas características incluyen: Peso Fertilidad Carcasa Otros

Más detalles



Más detalles


IDENTIFICACION DE VIENTRES DE ALTO MERITO PARA LA PRODUCCIÓN DE CARNE BOVINA IDENTIFICACION DE VIENTRES DE ALTO MERITO PARA LA PRODUCCIÓN DE CARNE BOVINA Principios generales y planilla electrónica para el cálculo de pesos ajustados y tasa anual de peso de destete en vacas de carne

Más detalles

Las Pruebas de Cruzamiento de California

Las Pruebas de Cruzamiento de California Las Pruebas de Cruzamiento de California ( Primeros resultados) La Universidad de Minnesota ha analizado los datos de siete grandes establecimientos lecheros comerciales en California, EE.UU. Los datos

Más detalles

Presente y Futuro en Reproducción Bovina. Gabriel Dalvit, DVM, PhD Facultad de Ciencias Veterinarias - INITRA Universidad of Buenos Aires - Argentina

Presente y Futuro en Reproducción Bovina. Gabriel Dalvit, DVM, PhD Facultad de Ciencias Veterinarias - INITRA Universidad of Buenos Aires - Argentina Presente y Futuro en Reproducción Bovina Gabriel Dalvit, DVM, PhD Facultad de Ciencias Veterinarias - INITRA Universidad of Buenos Aires - Argentina Región Centro Rosario 25 y 26 de junio de 2015 Servicio

Más detalles

Comprar un semental, con una fiabilidad del 99%, a una compañía de prestigio.

Comprar un semental, con una fiabilidad del 99%, a una compañía de prestigio. 1 1. Un director de agricultura de una comunidad autónoma que dispone de 20.000 vacas de leche cuya producción no está controlada quiere mejorar la calidad genética de los animales de su región, qué debe

Más detalles

Las herramientas del futuro: marcadores moleculares en mejoramiento animal

Las herramientas del futuro: marcadores moleculares en mejoramiento animal Las herramientas del futuro: marcadores moleculares en mejoramiento animal Ing. Agr. Pablo M. Corva, PhD Facultad de Ciencias Agrarias Univ. Nac. Mar del Plata Fenotipo Valor Mejorante (Breeding Value)

Más detalles

RAZAS LECHERAS: Introducción

RAZAS LECHERAS: Introducción RAZAS LECHERAS: Introducción Son numerosas las razas lecheras y de doble propósito en el mundo; sin embargo en México solo contamos con 3 razas que son las mas productivas del mundo: Jersey, Pardo Suizo

Más detalles



Más detalles

Secundarios - CBC - Universitarios - Informática - Idiomas. Apunte Nro 0742. Mendel. Ejercicios de genética.

Secundarios - CBC - Universitarios - Informática - Idiomas. Apunte Nro 0742. Mendel. Ejercicios de genética. Mendel. Ejercicios de genética. 1) La segunda ley de Mendel no se cumpliría si: a) los genes considerados estuvieran ubicados en distintos cromosomas b) los genes considerados estuvieran ubicados en un

Más detalles

Uso de la caña de azúcar y urea para la época seca

Uso de la caña de azúcar y urea para la época seca Uso de la caña de azúcar y urea para la época seca Rodolpho de Almeida Torres José Ladeira da Costa Introducción El bajo o nulo crecimiento de los pastos durante el periodo seco del año en las regiones

Más detalles

La translocación robertsoniana 1/29 en la raza Morucha.

La translocación robertsoniana 1/29 en la raza Morucha. La translocación robertsoniana 1/29 en la raza Morucha. Introducción. En la fecundación de los animales, concretamente en la meiosis, con muy poca frecuencia se producen errores que dan lugar a alteraciones

Más detalles


ROJO NORUEGO: OTRA ALTERNATIVA EN LA BÚSQUEDA DEL DOBLE PROPÓSITO ROJO NORUEGO: OTRA ALTERNATIVA EN LA BÚSQUEDA DEL DOBLE PROPÓSITO 10556 Motroen La ganadería doble propósito en Colombia se concibe como un sistema de manejo en donde se debe producir simultáneamente y

Más detalles


PRODUCTOS SEMEN RAZAS LECHERAS REPRODUCTORES SRL se dedica especialmente, desde hace más de treinta y tres años, a la importación, producción y distribución material genético: semen y embriones bovinos. PRODUCTOS SEMEN RAZAS LECHERAS

Más detalles


LA FORMACIÓN DE RAZAS COMPUESTAS LA FORMACIÓN DE RAZAS COMPUESTAS Volver a: Genética bovinos de carne INTRODUCCIÓN Daniel López. 2000. Sumario Ganadero, 3(3):74-77. Para lograr el mejoramiento genético de

Más detalles

Genética de futuro. Texto: Silvia Arroyo Fotografía: Aberekin

Genética de futuro. Texto: Silvia Arroyo Fotografía: Aberekin Genética de futuro Texto: Silvia Arroyo Fotografía: Aberekin El Centro de Inseminación Aberekin se puso en marcha en 1985 con dos objetivos principales. Por una parte, el Departamento de Agricultura y

Más detalles


MEJORAMIENTO DE LOS RODEOS MEJORAMIENTO DE LOS RODEOS Ing. Agr. Alejandro Cariola 2012 MEJORAMIENTO Selección No son mutuamente excluyentes, sino complementarias Cruzamientos Selección Se eligen los individuos

Más detalles

Estrategias Nutricionales para Manipular la Proteina de la Leche

Estrategias Nutricionales para Manipular la Proteina de la Leche Estrategias Nutricionales para Manipular la Proteina de la Leche Pedro Melendez, MV, MS, PhD College of Veterinary Medicine Universidad de Missouri, EEUU El 95% de la proteína de la leche es proteína verdadera,

Más detalles

MEMORIA 1992 DEL CENTRO DE SELECCIÓN Y REPRODUCCIÓN ANIMAL (SOMIÓ GIJÓN) SERIE MEMORIAS Nº. 10 / 93. Instituto de Experimentación y Promoción Agraria.


Más detalles


APAREAMIENTO O MONTA 636.08926 G195g V. 2 Ej. 1 División de Formación a Distancia División Agropecuaria División P.P.P.R. CAPACITACIÓN CAMPESINA APAREAMIENTO O MONTA Cartilla 2 Especialidad: Bloque: GANADERÍA REPRODUCCIÓN

Más detalles

Sistema de producción unidad vaca ternero e indicadores de eficiencia. Marcelo Hervé Médico Veterinario ICATC, FACVET, UACh mherve@uach.

Sistema de producción unidad vaca ternero e indicadores de eficiencia. Marcelo Hervé Médico Veterinario ICATC, FACVET, UACh mherve@uach. Sistema de producción unidad vaca ternero e indicadores de eficiencia. Marcelo ervé Médico Veterinario ICATC, FACVET, UACh Objetivos biológicos del rebaño comercial de vacas de crianza.

Más detalles


PROGRAMA DE MONITOREO DE LA LECHE EN MÉXICO PROGRAMA DE MONITOREO DE LA LECHE EN MÉXICO Dr. Felipe de Jesús Ruiz López Centro Nacional de Investigación en Fisiología y Mejoramiento Animal. INIFAP Holstein de México CONTENIDO Importancia del monitoreo

Más detalles

Semen sexado: una herramienta de alto rendimiento poco explotada

Semen sexado: una herramienta de alto rendimiento poco explotada Semen sexado: una herramienta de alto rendimiento poco explotada Como en todos los ámbitos de la vida humana, el desarrollo de tecnologías produce cambios radicales y mejoras sustantivas en la escala de

Más detalles

perro heterocigoto con una perra heterocigota y tienen 12 perritos, cuántos de éstos se espera que sean negros? cuántos se espera que sean marrón?.

perro heterocigoto con una perra heterocigota y tienen 12 perritos, cuántos de éstos se espera que sean negros? cuántos se espera que sean marrón?. UNIVERSIDAD NACIONAL ABIERTA Y A DISTANCIA UNAD ESCUELA DE CIENCIAS AGRICOLAS, PECUARIAS Y DEL MEDIO AMBIENTE EJERCICIO TALLER SOBRE PROBLEMAS DE HERENCIA MENDELIANA Para resolver em grupos y entregar

Más detalles

Enfermedades asociadas a mutaciones estructurales

Enfermedades asociadas a mutaciones estructurales Enfermedades asociadas a mutaciones estructurales El cariotipo humano A partir de un cultivo de sangre periférica, y posterior tratamiento con Giemsa para obtener un bandeo G, puede obtenerse el cariotipo

Más detalles



Más detalles


VALORES GENÉTICOS Y GENÓMICOS EN MEJORAMIENTO LECHERO VALORES GENÉTICOS Y GENÓMICOS EN MEJORAMIENTO LECHERO Médico Veterinario M. S. Ph. D. Héctor Uribe M. Departamento de Producción Animal, Universidad de Chile. I. INTRODUCCIÓN Desde un punto de vista de

Más detalles



Más detalles

Producción de leche en ganado cebú en el trópico. Rui da Silva Verneque João Cláudio do Carmo Panetto Embrapa Ganado de Leche

Producción de leche en ganado cebú en el trópico. Rui da Silva Verneque João Cláudio do Carmo Panetto Embrapa Ganado de Leche Producción de leche en ganado cebú en el trópico Rui da Silva Verneque João Cláudio do Carmo Panetto Embrapa Ganado de Leche Temas Ganado Cebú doble propósito Razas Cebú utilizadas en Brasil y mejor cruce

Más detalles

TEMA 18: Selección Asistida por Marcadores y Selección Genómica

TEMA 18: Selección Asistida por Marcadores y Selección Genómica TEMA 18: Selección Asistida por Marcadores y Selección Genómica 1 1.- Mejora genética convencional Mejora Genética Convencional Valores Fenotípicos Pedigrí Valores Fenotípicos Selección Mejora Genética

Más detalles

1 er Simposio de Actualización Genética para Bovinos de Carne. Daniel de Mattos

1 er Simposio de Actualización Genética para Bovinos de Carne. Daniel de Mattos 1 er Simposio de Actualización Genética para Bovinos de Carne Daniel de Mattos Proceso de Mejora Genética Meta Que cambiar? Objetivo de selección Que medir? Criterio de selección A quien medir? Cuanto

Más detalles

Genética Humana. Guía de problemas

Genética Humana. Guía de problemas Genética Humana Guía de problemas 2007 Leyes de Mendel y Extensiones 1- Se sabe que existe una serie de 4 alelos de un determinado gen en el hombre (2n); Cuántos estarían presentes en: a) un cromosoma?

Más detalles



Más detalles


CONSANGUINIDAD: COSTO OCULTO PARA LA GANADERÍA DE LECHE* Por: Juan Esteban Sánchez V. M.V.Z. CONSANGUINIDAD: COSTO OCULTO PARA LA GANADERÍA DE LECHE* Por: Juan Esteban Sánchez V. M.V.Z. Consanguinidad, endogamia o inbreeding, es el grado de parentesco que existe

Más detalles

Estimados clientes y amigos,

Estimados clientes y amigos, Estimados clientes y amigos, Es un gusto para nosotros volverlos a invitar a compartir el Remate de Toros para Vaquillonas. - La oferta será de 50 toros Red Angus SA de 2 años y 10 toros Angus Negro SA

Más detalles

Evaluación de la fertilidad: Monta Natural vs Inseminación Artificial

Evaluación de la fertilidad: Monta Natural vs Inseminación Artificial Fundación GIRARZ Evaluación de la fertilidad: Monta Natural vs Inseminación Artificial Ninoska Madrid Bury Facultad de Agronomía Universidad del Zulia Son muchos los ganaderos que asumen, que un toro sexualmente

Más detalles

Comparación de los Sistemas de Producción de ganado Bovino en Rep. Dom. Doble propósito Representa el 58% de la población bovina. Aporta 70% de la leche y el 55% de la carne producida. Es el más representativo

Más detalles

Análisis de paternidad y parentesco en alpacas (Vicugna pacos) mediante marcadores moleculares

Análisis de paternidad y parentesco en alpacas (Vicugna pacos) mediante marcadores moleculares Análisis de paternidad y parentesco en alpacas (Vicugna pacos) mediante marcadores moleculares MSc. Juan Agapito Panta Laboratorio de Genómica y Biología Molecular Instituto Peruano de Energía Nuclear

Más detalles

ANGUS HISTÓRICA EL PROGRAMA E.R.A. también tiene motivos para celebrar

ANGUS HISTÓRICA EL PROGRAMA E.R.A. también tiene motivos para celebrar EL PROGRAMA E.R.A. también tiene motivos para celebrar 66 El programa de evaluación genética de la Asociación ya incluye más de 427.000 reproductores Angus con DEP. TX Ing. Agr. Alfonso Bustillo Coordinador

Más detalles

12. Cómo pueden diferenciarse dos individuos, uno homocigótico de otro heterocigótico, que presentan el mismo fenotipo. Razonar la respuesta

12. Cómo pueden diferenciarse dos individuos, uno homocigótico de otro heterocigótico, que presentan el mismo fenotipo. Razonar la respuesta PROBLEMAS DE GENÉTICA: PRIMERA Y SEGUNDA LEYES DE MENDEL 1. En cierta especie de plantas el color azul de la flor, (A), domina sobre el color blanco (a) Cómo podrán ser los descendientes del cruce de plantas

Más detalles

El ganado de leche tiene forma triangular. El ganado de carne tiene forma rectangular

El ganado de leche tiene forma triangular. El ganado de carne tiene forma rectangular I TIPOS DE GANADO BOVINO 1. DIFERENCIAS ENTRE EL GANADO BOVINO PARA PRODUCCIÓN DE CARNE Y LECHE (1) Conformación física Si diferenciáramos el ganado bovino en 2 grupos, tendríamos el ganado que fue mejorado

Más detalles

Mejoramiento del ganado bovino en los trópicos. Dr. Juan Tomás Reyes

Mejoramiento del ganado bovino en los trópicos. Dr. Juan Tomás Reyes Mejoramiento del ganado bovino en los trópicos Dr. Juan Tomás Reyes GENOTIPO MAS AMBIENTE Capacidad digestiva de dos razas en diferentes ambientes Clima Tropical & Clima Templado Características del

Más detalles


VITALIDAD Y CRECIMIENTO PUBLICACIÓN TRIMESTRAL No. 27 VITALIDAD Y CRECIMIENTO Becerra sana. INTRODUCCIÓN El éxito del negocio de producir leche depende en gran medida de la calidad genética del ganado y la oportunidad que tengan

Más detalles

Evaluación Genética de Reproductores. Aberdeen Angus 2012

Evaluación Genética de Reproductores. Aberdeen Angus 2012 TAPA Evaluación Genética de Reproductores Aberdeen Angus 2012 Convenio: A.R.U. SCAAU Facultad de Agronomía INIA Logos de ARU, Sociedad de Criadores, INIA y Fac. de Agronomía Evaluación Genética de Reproductores

Más detalles



Más detalles

UD 3. La Revolución Genética

UD 3. La Revolución Genética UD 3. La Revolución Genética 1. INTRODUCCIÓN: El ADN, la genética. 2. La ingeniería genética 3. Para qué sirve la ingeniería genética? Aplicaciones 4. Transgénicos 5.El Proyecto Genoma Humano (PGH) 6.

Más detalles

Contenido. Pág. Área de Administración Agropecuaria

Contenido. Pág. Área de Administración Agropecuaria INTRODUCCIÓN El Proyecto PROGANIC está beneficiando a los productores de los Departamentos de Boaco y Chontales, lugares en donde su principal fuente de trabajo es la crianza de ganado a pequeña escala

Más detalles


- NOVIEMBRE 2007 GABRIEL ROVERE Mejora Genética en Bovinos de Leche Estrategias de Mejora Genética Selección entre razas Selección dentro de raza Gabriel Rovere Facultad de Agronomía Mejora Genética Animal Instituto Nacional para el

Más detalles

CRUZAMIENTO EN BOVINOS DE CARNE Manejo Reproductivo e Inseminación Artificial

CRUZAMIENTO EN BOVINOS DE CARNE Manejo Reproductivo e Inseminación Artificial BOLETÍN TÉCNICO Nº 2 CRUZAMIENTO EN BOVINOS DE CARNE Manejo Reproductivo e Inseminación Artificial 1ª Edición, Noviembre 2010 Copyright 2010 AGROPAMPA Los programas de mejoramiento genético que incorporan

Más detalles

EPD Genómico: El próximo Salto Tecnológico

EPD Genómico: El próximo Salto Tecnológico EPD Genómico: El próximo Salto Tecnológico Ing. Agr. Olga Ravagnolo, Ing. Agr. Ignacio Aguilar, Ing. Agr. Gabriel Ciappesoni, Ing. Agr. Fabio Montossi Programa Nacional de Carne y Lana, INIA Introducción

Más detalles

Tritrichomoniasis y Campylobacteriosis genital bovina

Tritrichomoniasis y Campylobacteriosis genital bovina Tritrichomoniasis y Campylobacteriosis genital bovina Publicado el: 01/10/2012 Autor/es: María Catena, Dr, M.V. Área de Enfermedades Infecciosas, Fac. de Cs. Vet- UNCPBA La tritrichomoniasis y campylobacteriosis

Más detalles

Tema 22.- HERENCIA MENDELIANA. Introducción a la Genética Humana: tipos de herencia. Herencia monogénica mendeliana

Tema 22.- HERENCIA MENDELIANA. Introducción a la Genética Humana: tipos de herencia. Herencia monogénica mendeliana BIBLIOGRAFÍA Jorde, Carey, Bamshad. Genética médica. Editorial Elsevier Mosby, 4ª Ed. (2011) Nussbaum, McInnes, Willard. (Thompson&Thompson). Genética en medicina. Editorial Elservier Masson, 5ª/7ª Ed.

Más detalles



Más detalles

Versión: 9.0 Alto Nivel

Versión: 9.0 Alto Nivel Versión: 9.0 Alto Nivel Versión 9.0 Alto Nivel, de Junio de 2008, Son 365 días continuos de trabajo en cada versión. Durante los últimos 18 años, hemos liberado cada mes de junio una nueva versión, donde

Más detalles

Crecimiento de las terneras

Crecimiento de las terneras Crecimiento de las terneras INTRODUCCION El propósito de alimentar, mantener y tener un buen manejo de la salud como se describió en los capítulos anteriores es el de asegurar un crecimiento adecuado.

Más detalles

Diferencias esperadas en la progenie (DEP o EPD)

Diferencias esperadas en la progenie (DEP o EPD) Diferencias esperadas en la progenie (DEP o EPD) Dr. Guillermo Martínez Velázquez Campo Experimental El Verdineño INIFAP- Nayarit DEPs Predecir el mérito genético de cada individuo Lo que puede transmitir

Más detalles


MANEJO REPRODUCTIVO EN EL RODEO BOVINO LECHERO: PROPUESTAS Y REFLEXIONES MANEJO REPRODUCTIVO EN EL RODEO BOVINO LECHERO: PROPUESTAS Y REFLEXIONES Volver a: Inseminación artificial M.V. Claudio E. Glauber*. 2007. Facultad Ciencias Veterinarias, Universidad de Buenos Aires, Argentina.

Más detalles


SEMEN SEXADO, UNA HERRAMIENTA TECNOLÓGICA PARA EL TAMBO SEMEN SEXADO, UNA HERRAMIENTA TECNOLÓGICA PARA EL TAMBO Med. Vet. Lucas E. Cutaia 1, Guillermo Veneranda 2 y Gabriel Bo 3. 2007. Producir XXI, Bs.As., 15(188):52-57. 1-Instituto de Reproducción Animal

Más detalles

Carne + Lana + Piel LECHE. 25% del producto final proviene de la CARNE

Carne + Lana + Piel LECHE. 25% del producto final proviene de la CARNE OVINO LECHERO Cualquier animal de esta especie susceptible de proporcionar regularmente una cantidad de leche para consumo humano, además de la necesaria para alimentar a las crías Carne + Lana + Piel

Más detalles


LACTANCIA Y DESTETE DEFINITIVO LACTANCIA Y DESTETE DEFINITIVO Volver a: Cría: Amamantamiento Bavera, G. A. 2005. Cursos de Producción Bovina de Carne, FAV UNRC. PRODUCCIÓN DE LECHE Y PESO AL DESTETE La vaca

Más detalles

Marcadores Moleculares en Pollos. Gabriela. M. Iglesias, M.V. MSc

Marcadores Moleculares en Pollos. Gabriela. M. Iglesias, M.V. MSc Firmado digitalmente por Gabriela Iglesias Nombre de reconocimiento (DN): CN = Gabriela Iglesias, C =

Más detalles

Selección Genómica: Una Nueva Era para la Producción Porcina

Selección Genómica: Una Nueva Era para la Producción Porcina Selección Genómica: Una Nueva Era para la Producción Porcina Dr. Armand Sánchez. Director de Vetgenomics S.L. Universidad Autónoma de Barcelona 1-3 octubre 2013 - Isla de A Toxa - España El futuro de las

Más detalles


EL GANADO BOVINO CRIOLLO EN ARGENTINA EL GANADO BOVINO CRIOLLO EN ARGENTINA Martínez, R.D., E.N. Fernández, E.R. Género y F.J.L. Rumiano. 2000. Arch. Zootec. 49:353-361. Cátedra Genética Animal, Facultad de Ciencias Agrarias U.N.L.Z., Argentina.

Más detalles

Entendiendo Como Utilizar los Grupos de Manejo en BREEDPLAN

Entendiendo Como Utilizar los Grupos de Manejo en BREEDPLAN Entendiendo Como Utilizar los Grupos de Manejo en BREEDPLAN El uso de grupos de manejo es uno de los aspectos más importantes de BREEDPLAN. Este documento le brinda información detallada acerca de los

Más detalles

Problemas de genética mendeliana. Herencia de un carácter

Problemas de genética mendeliana. Herencia de un carácter Problemas de genética mendeliana Herencia de un carácter 1. Razona la veracidad o falsedad de la siguiente afirmación: El color de tipo común del cuerpo de la Drosophila está determinado por el gen dominante

Más detalles

Revolución genética (tema 4) Raquel Pascual, Paula Pardo y Jaime Parras

Revolución genética (tema 4) Raquel Pascual, Paula Pardo y Jaime Parras Revolución genética (tema 4) Raquel Pascual, Paula Pardo y Jaime Parras Diferencia entre los seres vivos 1. Pedruscos y bichos, Qué los diferencia? Dos tipos de objeto seres vivos (pueden hacer copias

Más detalles

Cruzamientos en Cuba: Experiencias y perspectivas. Introducción

Cruzamientos en Cuba: Experiencias y perspectivas. Introducción 29 Cruzamientos en Cuba: Experiencias y perspectivas Delia López Asociación Cubana de Producción Animal, Calle 10 N 351 e/15 y 17 Plaza La Habana 10300, Cuba Introducción La temática de cómo lograr incrementos

Más detalles


SISTEMAS DE PRODUCCION SISTEMAS DE PRODUCCION Ricardo Vidal Mugica MV, MSc. Unidad de Gestión de la Producción Animal, ICATC El concepto de sistema de producción se basa en la Teoría General de Sistemas que fue desarrollada

Más detalles

Importancia de la alimentación con calostro

Importancia de la alimentación con calostro Importancia de la alimentación con calostro CALOSTRO Y RESISTENCIA A LAS ENFERMEDADES DE LAS TERNERAS RECIEN NACIDAS Que es el calostro? El calostro es una secreción densa, cremosa y amarilla que es colectada

Más detalles

Departamento Administrativo Nacional de Estadística

Departamento Administrativo Nacional de Estadística Departamento Administrativo Nacional de Estadística Diseño DSO Dirección de Metodología y Producción Estadística -DIMPE Ficha Metodológica Encuesta de Sacrificio de Ganado -ESAG- Octubre 2014 PÁGINA: 1

Más detalles



Más detalles


IMPORTANCIA DE LOS REGISTROS PECUARIOS IMPORTANCIA DE LOS REGISTROS PECUARIOS SISTEMAS DE REGISTROS PECUARIOS INTRODUCCION En la actualidad los productores de ganado deben de ser más que simples ganaderos y convertirse en empresarios eficientes,

Más detalles

Genética Mendeliana y mutaciones genéticas. Herencia Leyes de Mendel Compilado

Genética Mendeliana y mutaciones genéticas. Herencia Leyes de Mendel Compilado Genética Mendeliana y mutaciones genéticas Herencia Leyes de Mendel Compilado Introducción Genética es la ciencia que estudia como se transmiten las características de generación a generación. Gregor Mendel

Más detalles

El cuerpo humano está formado por un conjunto de células y dentro de ellas se encuentra el ADN (Acido Desoxirribonucleico).

El cuerpo humano está formado por un conjunto de células y dentro de ellas se encuentra el ADN (Acido Desoxirribonucleico). El cuerpo humano está formado por un conjunto de células y dentro de ellas se encuentra el ADN (Acido Desoxirribonucleico). Es una sustancia química determinada por la técnica de PCR Reacción en Cadena

Más detalles


EVALUACIÓN GENÉTICA NACIONAL DEL VACUNO FRISÓN ESPAÑOL Noviembre 2015 EVALUACIÓN GENÉTICA NACIONAL DEL VACUNO FRISÓN ESPAÑOL Las evaluaciones genéticas nacionales del vacuno frisón español son calculadas íntegramente en CONAFE mediante el método BLUP Modelo

Más detalles

Paratuberculosis. Paratuberculosis. Efectos Sobre Caracteres de Importancia Económica. en Bovinos de Carne? Motivación. Transmisión.

Paratuberculosis. Paratuberculosis. Efectos Sobre Caracteres de Importancia Económica. en Bovinos de Carne? Motivación. Transmisión. Tiene Paratuberculosis Subclínica s Sobre Caracteres de Importancia Económica en Bovinos de Carne? M. A. Elzo,, D. O. Rae, S. E. Lanhart, J. G. Wasdin, W. P. Dixon, J. L. Jones, and J. D. Driver University

Más detalles

Sistemas de Producción de Leche en la Argentina

Sistemas de Producción de Leche en la Argentina Sistemas de Producción de Leche en la Argentina Méd.Vet. Armando López Área de Producción Bovinos de Leche Facultad de Ciencias Veterinarias, UBA En el mundo se pueden diferenciar dos

Más detalles



Más detalles

Criterios para la formación de razas lecheras tropicales

Criterios para la formación de razas lecheras tropicales 2 Criterios para la formación de razas lecheras tropicales Abelardo Rodríguez Voigt Genética Tropical C.A.Caracas-Venezuela El ganado fue originario o autóctono en todos los países

Más detalles
Physics In Our Lives | Beloved Wife is not Well-Behaved | Alaska The Last Frontier S08E08 To Live or Die on Perl Island 720p HDTV x264-W4F [eztv]